Contact

Daria Pašalić
Editor-in-Chief
Department of Medical Chemistry, Biochemistry and Clinical Chemistry
Zagreb University School of Medicine
Šalata ul 2.
10 000 Zagreb, Croatia
Phone +385 (1) 4590 205; +385 (1) 4566 940
E-mail: dariapasalic [at] gmail [dot] com

Useful links

Izvorni znanstveni članak

 
Jana Dragojevič, Janja Marc, Barbara Mlinar. Udruženost polimorfizama Pro12Ala i His477His gena PPARG s inzulinskom rezistencijom u bolesnica sa sindromom policističnih jajnika. Biochemia Medica 2008;18(3):342-50.
Zavod za kliničku biokemiju Farmaceutskog fakulteta Sveučilišta u Ljubljani, Ljubljana, Slovenija
*Adresa za dopisivanje: janja [dot] marc [at] ffa [dot] uni-lj [dot] si
 
Sažetak
Uvod: Inzulinska rezistencija je obilježena oslabljenim tkivnim odgovorom na djelovanje inzulina, a udružena je s pretilošću, šećernom bolesti tipa 2, metaboličkim sindromom, lipodistrofijama, sindromom policističnih jajnika (engl. polycysticovarysyndrome, PCOS) i kroničnom infekcijom. Inzulinska rezistencija je prisutna kod 50–70% bolesnica s PCOS. Peroksizomni proliferatorom aktivirani receptor gama (engl. peroxisome proliferator-activated receptor γ, PPARγ) je jezgreni receptor koji kontrolira transkripciju gena uključenih u metabolizam slobodnih masnih kiselina i lipogenezu, a važan je za diferencijaciju i preživljenje adipocita. Cilj ovoga probnog istraživanja bio je ispitati povezanost polimorfizama Pro12Ala i His477His PPARG gena s inzulinskom rezistencijom kod bolesnica s PCOS.
Bolesnice i metode: U istraživanju je sudjelovalo 69 bolesnica s PCOS. Metodom PCR-RFLP analizirane su frekvencije genotipa. Glukoza natašte i glukoza nakon oralnog testa opterećenja glukozom (engl. oral glucose tolerance test, OGTT), inzulin, hsCRP (engl. high sensitivity C-reactive protein), tjelesna masa, visina, opseg struka, sistolični i dijastolični krvni tlak, indeks tjelesne mase (engl. body mass index, BMI) i indeks procjene modela homeostaze (engl. homeostasis model assessment, HOMA) izmjereni su rutinskim metodama ili su izračunati iz podataka.
Rezultati: Pronađena je značajna povezanost između alela G polimorfizma Pro12Ala i nižeg BMI (P = 0,040) te između T alela polimorfizma His477His i niže koncentracije hsCRP (P = 0,047). Polimorfizmi Pro12Ala i His477His pokazali su značajnu neravnotežu povezanosti (engl. linkage disequilibrium) (D’ = 0,727). Analiza diplotipova nije pokazala da postoji povezanost.
Zaključak: U ovom preliminarnom istraživanju pronašli smo značajnu povezanost između alela G polimorfizma Pro12Ala i nižeg BMI te alela T polimorfizma His477His i nižeg hsCRP. Međutim, niti jedan od ova dva polimorfizma, pojedinačno ili u kombinaciji (diplotip), nije bio povezan s koncentracijama inzulina i glukoze natašte u plazmi, kao ni s indeksom HOMA, koji su znakoviti za inzulinsku rezistenciju. Stoga zaključujemo kako istraživani polimorfizmi nisu povezani s inzulinskom rezistencijom kod bolesnica s PCOS.
Ključne riječi: PPARγ, polimorfizam, inzulinska rezistencija, PCOS, hsCRP
Pristiglo: 8. travnja 2008.                                                                                         Prihvaćeno: 12. kolovoza 2008.
 
 
Uvod
Sindrom policističnih jajnika (engl. polycystic ovary syndrome, PCOS) je metabolički i reproduktivni poremećaj koji zahvaća 5–10% žena u reproduktivnim godinama (1). Obilježava ga povećano izlučivanje androgena iz jajnika i nadbubrežne žlijezde, hiperandrogenični simptomi (hirzutizam, akne, alopecija), neredoviti menstrualni ciklusi i inzulinska rezistencija (2) koja je prisutna kod 50–70% bolesnica s PCOS. Uz inzulinsku rezistenciju prisutne su često i druge značajke metaboličkog sindroma Špretilost, dislipidemija, hipertenzija i poremećena tolerancija glukoze (engl. impaired glucose tolerance, IGT)Ć. Uz PCOS i metabolički sindrom, inzulinska rezistencija povezana je i s pretilošću, šećernom bolesti tipa 2, lipodistrofijama i kroničnom infekcijom. Podaci govore kako je sveukupna učestalost inzulinske rezistencije 10–25% (1). Inzulinsku rezistenciju obilježava slab tkivni odgovor na djelovanje inzulina, a može biti uzrokovana poremećajima na bilo kojoj razini inzulinskog signalnog puta. Klinički biljezi inzulinske rezistencije su visceralna pretilost, crnkasta akantoza, akne, prekomjerna dlakavost i jetrena steatoza. Hiperinzulinemijska euglikemijska spona (engl. hyperinsulinemic euglycemic clamp) smatra se zlatnim standardom za procjenu inzulinske rezistencije. Zbog invazivnosti ove metode razvijaju se i alternativna mjerenja, kao npr. mjerenje koncentracije inzulina u plazmi natašte, indeks procjene modela homeostaze (engl. homeastasis model assessment, HOMA), kvantitativni indeks provjere inzulinske osjetljivosti (engl. quantitative insulin sensitivity check index, QUICKI) i McAuleyev indeks (1).
Receptori PPAR (engl. peroxisome proliferator-activated receptors) su jezgreni receptori koji kontroliraju transkripciju gena. Postoje tri tipa PPAR: PPARα, PPARβ (također poznat kao PPARδ) i PPARγ. PPARγ ima važnu ulogu kao regulator ekspresije adipocitnog gena. Specifična aktivacija PPARγ izaziva diferencijaciju predadipocita u zrele adipocite u staničnim linijama ljudi i glodavaca (3). PPARγ regulira transkripciju proteina uključenih u metabolizam slobodnih masnih kiselina (engl. free fatty acids, FFA) (aP2 protein koji veže FFA specifične za adipocit, lipoproteinska lipaza, proteini transporteri masnih kiselina FATP i CD36, adipofilin, jetreni X receptor α) i lipogenezu (dugolančana acil-CoA sintaza, fosfoenolpiruvat-karboksikinaza) (4). Uz diferencijaciju adipocita, PPARγ je isto tako bitan za preživljenje zrelih adipocita in vitro (5).
Gen PPARG nalazi se na kromosomu 3p25. Ima 146 kbp i sastoji se od 9 eksona. Kodira 4 različite mRNA koje se prepisuju u 2 različite proteinske izoforme (PPARγ1 and PPARγ2) pomoću različitih promotora i alternativnog izrezivanja. Izoforma PPARγ2 ima 30 dodatnih aminokiselina na svom N-terminalnom kraju i pokazuje pet do šest puta povećanu funkciju aktiviranja ovisnu o ligandu (5). Polimorfizam Pro12Ala nalazi se u eksonu B i stoga je prisutan samo u izoformi PPARγ2. Polimorfizam His477His leži u eksonu 6 i može se naći u obje izoforme proteina (Slika 1.). PPARγ koji sadrži alel G ima slabiju transkripcijsku aktivnost nego onaj koji sadrži alel C in vitro. To su potvrdila i 3 pojedinačna istraživanja in vivo (7).
 
 
 
Slika 1. Gen PPARγ i mRNAs. Izoforma PPARγ1 dugačka je 475 aminokiselina i rezultat je transkripcije PPARγ1, PPARγ3 i PPARγ4 mRNA. Izoforma PPARγ2 ima dodatnih 30 aminokiselina na svojem N-terminalnom kraju. PPARγ1 izražen je ubikvitarno dok je PPARγ2 adipozno specifičan. PPARγ3 je izražen u makrofazima, adipoznom tkivu i debelom crijevu. Lokalizacija ekspresije PPARγ4 još nije definirana. (Prema ref. 6).
 
Cilj našega preliminarnog istraživanja bio je utvrditi povezanost između polimorfizama Pro12Ala i His477His u genu PPARG i njihovih diplotipova s inzulinskom rezistencijom kod bolesnica s PCOS. Iako postoji mnogo istraživanja polimorfizma Pro12Ala i/ili His477His, često s oprečnim rezultatima, mi smo prvi proveli ovakvu vrstu istraživanja na slovenskoj skupini bolesnica s PCOS da bismo utvrdili udruženost diplotipova s hsCRP kod bolesnica s PCOS.
 
Bolesnice i metode
Bolesnice
Naše je istraživanje uključivalo 69 žena (bjelkinja) iz Slovenije s dijagnosticiranim PCOS prema kriterijima NICHD (engl. National Institute of Child Health and Human Development). Ispitivanje je odobrio Etički odbor i sve su bolesnice potpisale obaviješteni pristanak.
 
Metode
Antropometrijska mjerenja uključivala su mjerenje tjelesne težine, visine i opsega struka. Rutinskim se metodama bolesnicama mjerio sistolički i dijastolički tlak. Za genetska istraživanja i određivanje biokemijskih parametara vadila se periferna krv natašte. Glukoza se izmjerila nakon oralnog testa opterećenja glukozom (OGTT) metodom GOD-PAP (Roche Hitachi 917, Roche, Mannheim, Njemačka). Kemilumiscentna imunokemijska metoda primijenjena je za mjerenja koncentracija inzulina (Liaison Insulin, Diasorin, Saluggia VC, Italija) i hsCRP (Immulite, DPC Inc., Los Angeles, SAD). Svi su parametri izmjereni u certificiranom laboratoriju rutinski provjerenim metodama. Indeks HOMA izračunao se iz podataka prema slijedećoj jednadžbi:
 
HOMA-IR = inzulin natašte (mU/L) × glukoza natašte (mmol/L)/22,5 (8).
 
DNA je izolirana iz periferne krvi pomoću FlexiGene DNA Kit (Qiagen, Hilden, Njemačka). Genotipovi su određeni metodama PCR-RFLP. Polimorfizam Pro12Ala je genotipiziran uporabom početnice s krivo sparenim bazama i restrikcijskog enzima HpaII (New England Biolabs, Ipswich, MA, SAD) koji su prethodno opisali Globočnik i sur. (9). Polimorfizam His477His (druga imena: C161T, C1431T, His447His i CAC477CAT) genotipiziran je pomoću početnica PPARG-Ex6_F: CAGGTTTGCTGAATGTGAAGC i PPARG-Ex6_R: TGGCTCAGGACTCTCTGCTAGT (dizajniran programom Primer3) i restrikcijskim enzimom NlaIII (New England Biolabs, Ipswich, MA, SAD). U genotipiziranju pomoću RFLP uvijek se rabila negativna kontrola i najmanje je 10% uzoraka rađeno u duplikatu.
 
Statistička analiza
Hardy-Weinbergova ravnoteža određena je Courtlabovim kalkulatorom (10). Podaci su analizirani programom SPSS 13.0 na operativnom sustavu Windows. Vrijednost P < 0,05 smatrala se statistički značajnom. Raspodjela podataka testirala se Kolmogorov-Smirnovljevim testom. Veza genotipa s kliničkim biljezima ispitivala se Studentovim t-testom za varijable s normalnom raspodjelom ili Mann-Whitneyevim testom za varijable koje nisu imale normalnu raspodjelu. Frekvencije haplotipova izračunale su se programom LDA 1.0 (11). Haplotipovi su se pridruživali programom HAP (12). Udruženost diplotipova s kliničkim biljezima uz homogenu varijancu analizirala se pomoću testa ANOVA i post hoc testa (Bonferroni, Scheffe, Tukey HSD). Udruženost diplotipova s kliničkim biljezima s nehomogenom varijancom analizirala se Kruskal-Wallisovim testom. 
 
Rezultati
U našoj su skupini ispitanica frekvencije genotipova za oba polimorfizma bile unutar Hardy-Weinbergove ravnoteže. Frekvencije genotipova i alela prikazane su u tablici 1. Prema indeksu HOMA koji je bio iznad 2,0, 34 bolesnice s PCOS imale su inzulinsku rezistenciju. Značajna je razlika u BMI pronađena među podskupinama genotipa Pro12Ala (tablica 2.), gdje su nosioci alela G imali niži BMI (C/C BMI = 28,9 ± 7,2 kg/m2 prema C/G BMI = 25,2 ± 5,2 kg/m2; p= 0,040). Polimorfizam Pro12Ala nije bio povezan sa sistoličkim i dijastoličkim tlakom, opsegom struka, koncentracijom glukoze natašte i nakon OGTT, koncentracijom inzulina natašte, indeksom HOMA ili hrCRP.
 
Tablica 1. Frekvencije alela i genotipova polimorfizama Pro12Ala i His477His kod bolesnica s policističnom bolesti jajnika (PCOS)
 
 
Značajna razlika nađena je i kod polimorfizma His477His u odnosu na hsCRP (tablica 2.). Nosioci alela T imali su niže koncentracije hsCRP i time manji rizik od razvoja srčanožilnih bolesti (podaci su iskazani kao medijan (gornji kvartil – donji kvartil); C/C hsCRP = 1,22 (0,39–4,15) mg/L prema C/T + T/T hsCRP = 0,60 (0,25–1,45) mg/L; P = 0,047). Polimorfizam His477His nije bio povezan s BMI, sistoličkim i dijastoličkim tlakom, opsegom struka, koncentracijom glukoze natašte i nakon OGTT, koncentracijom inzulina natašte ili indeksom HOMA.
 
Tablica 2. Klinički i biokemijski parametri u podskupinama prema genotipovima Pro12Ala i His477His polimorfizama
 
 
Također je napravljena i analiza haplotipova. Polimorfizmi Pro12Ala i His477His bili su u značajnoj neravnoteži povezanosti (engl. linkage disequilibrium, LD) (D’ = 0.727) (Tablica 3.). Od deset teoretski mogućih diplotipova našli smo ih samo pet. Samo je kod jedne bolesnice nađen G-T/C-T diplotip te je ona isključena iz daljnje statističke analize. Za ostale diplotipove ispitivale su se povezanosti kako bi se pronašli klinički i biokemijski biljezi inzulinske rezistencije. Testiranje je pokazalo kako nema nikakve značajne povezanosti (podaci nisu prikazani).
 
Tablica 3. Frekvencije haplotipova i diplotipovi
 
 
Rasprava
Pronašli smo značajnu povezanost između alela G polimorfizma Pro12Ala i niskog BMI te između alela T polimorfizma His477His i niske vrijednosti hsCRP, ali niti jedan od ta dva polimorfizma nije bio povezan s koncentracijama glukoze i inzulina natašte niti s indeksom HOMA. Analizom diplotipova također nije pronađena povezanost s antropometrijskim i biokemijskim biljezima inzulinske rezistencije kod PCOS.
Pro12Ala je čest polimorfizam; frekvencija alela G ovisna je o rasi i kreće se od 1% do 16%. Naši rezultati kod bolesnica s PCOS pokazali su frekvenciju alela G od 13,8%. Te su frekvencije slične onima utvrđenima kod populacije Danske (13), Škotske (14,15), Finske (16), Francuske (17), Indije (18), SAD (19) i Slovenije (9). Niže frekvencije alela (8%) pronađene su kod bjelkinja u SAD, te 1–4% kod Amerikanki afričkog podrijetla (20), te kod žena u Kini, Maleziji (18), Koreji (21) i Italiji (22). U više se studija ispitivao utjecaj alela G na tkivnu osjetljivost na inzulin. Neke studije su pokazale da alel G poboljšava tkivnu osjetljivost na inzulin, neke nisu našle nikakvu povezanost, a zanimljivo je da niti jedno istraživanje nije pronašlo negativan utjecaj alela G. Rezultati su joj više neujednačeni glede šećerne bolesti. Neka su istraživanja povezala alel G sa smanjenim rizikom, druga pak s povećanim rizikom za šećernu bolest tipa 2, dok neka nisu našla nikakvu povezanost (7).
Polimorfizam His477His može se naći pod raznim imenima: C161T, C1431T, His447His i CAC477CAT. Frekvencija alela T kreće se od 6,5% do 25,2% ovisno o rasi. Ustanovljena frekvencija alela T za polimorfizam His477His kod bolesnica s PCOS u našem istraživanju bila je 12,3%. Slične su frekvencije alela pronađene kod populacija Francuske (17,23), SAD (19) i Škotske (14,15). Nešto više frekvencije alela zabilježene su kod žena u Australiji (24) i Indiji, a još veće (19–25%) u Kini, Maleziji (18) i Finskoj (16).
Statistička analiza je pokazala značajnu povezanost između alela G polimorfizma Pro12Ala i BMI, gdje su nosioci alela G imali niži BMI. Neka od objavljenih korelacijskih istraživanja nisu pokazala značajnu povezanost između alela G i BMI (13,21); tri takva istraživanja su provedena u žena oboljelih od PCOS (20,22,25). Druga su ustanovila da nosioci alela G imaju viši BMI (16,18,19). Sva su ta istraživanja provedena na 2 do 60 puta većem broju ispitanica nego u našoj studiji. Meta-analiza koja je uključivala podatke iz 30 istraživanja (~19.000 ispitanika) pronašla je značajnu povezanost alela G kod ispitanika s BMI višim od 27 kg/m2 (26). Druga je meta-analiza uključivala podatke iz 57 istraživanja (~32.000 ispitanika) i pokazala da polimorfizam Pro12Ala nije povezan sa značajkama šećerne bolesti, no u određenim podskupinama (bijelci, pretili ispitanici), alel G bio je povezan s višim BMI i višom inzuliskom osjetljivošću (27).
U našem istraživanju polimorfizam Pro12Ala nije pokazao povezanost s opsegom struka, dijastoličkim i sistoličkim tlakom, što se slaže s rezultatima Frederiksena i sur. (13), ali se ne slaže s onima Valve i sur. i Wei i sur. (16,19) gdje je alel G bio udružen s većim opsegom struka, dakle, višim BMI. U niti jednom istraživanju (13,16,21,22,25), kao niti u našemu, nije pronađena povezanost između alela G i koncentracije glukoze i inzulina natašte i/ili indeksa HOMA. Hara i sur. (20) nisu pronašli značajnu povezanost alela G i koncentracije glukoze natašte i nakon OGTT, no kod nosioca alela G pronađene su značajno niže koncentracije inzulina i niži indeks HOMA. Slično kao i u našoj studiji, alel G nije bio povezan s koncentracijom inzulina natašte niti u istraživanjima autora Tai i sur. (18) i Wei i sur. (19), ali je bio povezan s višim [Tai i sur., (18)] odnosno nižim [Wei i sur., (19)] koncentracijama glukoze. U literaturi nema izvješća o istraživanjima povezanosti polimorfizma Pro12Ala i hsCRP kod bolesnica s PCOS.
Naša je statistička analiza polimorfizma His477His pokazala značajnu povezanost s hsCRP; kod nosioca alela T koncentracija hsCRP bila je niža. Slično kao Meirhaeghe i sur. (23), nismo našli povezanost alela T s BMI. Suprotno našim rezultatima, u nekoliko je istraživanja (16,18,19,22) pronađena povezanost alela T s višim BMI. U našem istraživanju, kao i kod Wei i sur. (19), alel T nije bio povezan s opsegom struka ili je bio povezan s većim opsegom struka (16), što je suprotno našim rezultatima. Meirhaeghe i sur. (23) nisu, kao ni mi, našli povezanost između alela T i sistoličkog i dijastoličkog tlaka. U našem istraživanju nismo pronašli povezanost alela T s koncentracijom glukoze i inzulina natašte te, što je slično rezultatima nekih istraživanja (16,18,19,22,23). Pokazali smo da je alel T povezan s smanjenim hsCRP i stoga smanjenim rizikom od razvoja srčanožilnih bolesti. Slične su rezultate objavili i Wang i sur. kod kojih su nosioci alela T imali niži rizik od razvoja srčanožilnih bolesti, povezanost koja se vidi osobito kod C/T heterozigota (24).
Proveli smo analizu diplotipova i ustanovili stupanj neravnoteže povezanosti (engl. degree of linkage disequilibrium) D’ = 0,727, što je slično onom što ga kod bolesnika s šećernom bolesti opisuju Doney i sur. iz Škotske (D’ = 0,697) (14). Nešto niži D’ pronađeni su u drugim istraživanjima među bolesnicima s šećernom bolesti iz Škotske (D’ = 0,663), zdravom djecom (D’ = 0,638) i zdravim odraslim osobama (D’ = 0,608) (15), bijelim Amerikancima (D’ = 0,65) (19), Kinezima (D’ = 0,555) i Malezijcima (D’ = 0,572). Viši stupanj neravnoteže povezanosti pronađen je kod Indijaca (D’ = 0,799) (18). Frekvencije haplotipova kod naših ispitanica (Tablica 3.) bile su slične onima što su našli Doney i sur. u dvama istraživanjima na populaciji Škotske (14,15).
Naši su rezultati pokazali da diplotip nije povezan niti s jednim od antropometrijskih ili biokemijskih biljega. Štoviše, Doney i sur. su pokazali da je haplotip Pro-T povezan s višim BMI u usporedbi s haplotipovima Pro-C ili Ala-C kod škotskih ispitanika sa šećernom bolesti i bez nje (14).
Uzimajući u obzir činjenicu da su rezultati nekoliko ispitivanja nedosljedni, moguće je da polimorfizmi Pro12Ala i His477His imaju tek manji utjecaj na inzulinsku rezistenciju. U našem probnom istraživanju pojedinačnih polimorfizama pokazali smo kako nosioci alela G polimorfizma Pro12Ala imaju niži BMI, a nosioci alela T polimorfizma His477His niži hsCRP, što su dva rizična čimbenika za razvoj inzulinske rezistencije. Međutim, povezanost s indeksom HOMA i koncentracijom inzulina natašte, koji su oba biljezi inzulinske rezistencije, nije zabilježena u našem istraživanju. Stoga zaključujemo kako istraživani polimorfizmi nisu povezani s inzulinskom rezistencijom kod bolesnica s PCOS.
 
Zahvala
Istraživanje je provedeno uz potporu Slovenske agencije za istraživanja, istraživački program br. P3-0298.
 
Literatura
1.    Mlinar B, Marc J, Janež A, Pfeifer M. Molecular mechanisms of insulin resistance and associated diseases. Clin Chim Acta 2007;375:20-35.
2.    Escobar-Morreale HF, Luque-Ramirez M, San Millan JL. The molecular-genetic basis of functional hyperandrogenism and the polycystic ovary syndrome. Endocr Rev 2005;26:251-82.
3.    Ferre P. The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 2004:53:S43-S50.
4.    Cock TA, Houten SM, Auwerx J. Peroxisome proliferator-activated receptor-γ: too much of a good thing causes harm. EMBO Rep 2004;5:142-7.
5.    Knouff C, Auwerx J. Peroxisome proliferator-activated receptor- calls for activation in moderation: lessons from genetics and pharmacology. Endocr Rev 2004;25:899-918.
6.    Merihaeghe A, Fajas L, Gouilleux F, Cottel D, Helbecque N, Auwerx J, et al. A functional polymorphism in a STAT5B site of the human PPARγ3 gene promoter affects height and lipid metabolism in a French population. Arterioscler Thromb Vasc Biol 2003;23:289-94.
7.    Meirhaeghe A, Amouyel P. Impact of genetic variation of PPARγ in humans. Mol Genet Metab 2004;83:93-102.
8.    Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and ß cell function from fasting plasma glucose and insulin concentration in man. Diabetologia 1985;28:412-9.
9.    GlobočnikPetrovič M, KunejT, PeterlinB, Dovč P, Petrovič D. Gly482Serpolymorphismoftheperoxisomeproliferator-activatedreceptor-γcoactivator-1 genemightbeariskfactorfordiabeticretinopathyinSlovenepopulation (Caucasians) withtype 2 diabetesandthePro12AlapolymorphismofPPARγgeneisnot. Diabetes Met Res Rev 2005;21:470-4.
10. Court lab – HW calculator. Court MH. Available at: www.tufts.edu/~mcourt01/Documents/Court%20lab%20-%20HW%20calculator.xls Accessed Jul 23th 2008.
11. Ding K, Zhou K, He F, Shen Y. LDA - a java-based linkage disequilibrium analyzer. Bioinformatics 2003;19:2147-8.
12. Halperin E, Eskin E. Haplotype reconstruction from genotype data using imperfect phylogeny. Bioinformatics 2004;20:1842-9.
13. Frederiksen L, Brǿdbǽk K, Fenger M, Jǿrgensen T, Borch-Johnsen K, Madsbad SM, et al. Studies of the Pro12Ala polymorphism of the PPARγ gene in the Danish MONICA cohort: homozygosity of the G allele confers a decreased risk of the insulin resistance syndrome. J Clin Endocrinol Metab 2002;87:3989-92.
14. Doney A, Fischer B, Frew D, Cumming A, Flavell D, World M, et al. Haplotype analysis of the PPARγ Pro12Ala and C1431T variants reveals opposing associations with body weight. BMC Genet 2002;3:21.
15. Doney ASF, Fischer B, Cecil JE, Boylan K, McGuigan FE, Ralston SH, et al. Association of the Pro12Ala and C1431T variants of PPARG and their susceptibility to type 2 diabetes. Diabetologia 2004;47:555-8.
16. Valve R, Sivenius K, Miettinen R, Pihlajamaki J, Rissanen A, Deeb SS, et al. Two polymorphisms in the peroxisome proliferator-activated receptor-γ gene are associated with severe overweight among obese women. J Clin Endocrinol Metab 1999;84:3708-12.
17. Meirhaeghe A, Cottel D, Amouyel P, Dallongeville J. Association between PPARγ haplotypes and the metabolic syndrome in French men and women. Diabetes 2005;54:3043-8.
18. Tai SE, Corella D, Deurenberg-Yap M, Adicons X, Chew SK, Tan CE, et al. Differential effects of the C1431T and Pro12Ala PPARγ gene variants on plasma lipids and diabetes risk in an Asian population. J Lipid Res 2004;45:674-85.
19. Wei Q, Jacobs DR, Schreiner PJ, Siscovick DS, Steffes MW, Fornage M. Patterns of association between PPARγ genetic variation and indices of adiposity and insulin action in African-Americans and whites: the CARDIA Study. J Mol Med 2006;84:955-65.
20. Hara M, Alcoser SZ, Qaadir A, Beiswenger KK, Cox NJ, Ehrmann DA. Insulin resistance is attenuated in women with polycystic ovary syndrome with the Pro12Ala polymorphism in the PPARγ gene. J Clin Endocrinol Metab 2002;87:772-5.
21. Kang SE, Park SY, Kim HJ, Kim SC, Ahn CW, Cha BS, et al. Effects of Pro12Ala polymorphism of peroxisome proliferator-activated receptor γ2 gene on rosiglitazone response in type 2 diabetes. Clin Pharmacol Ther 2005;78:202-8.
22. Orio F Jr, Matarese G, Di Biase S, Palomba S, Labella D, Sanna V, et al. Exon 6 and 2 peroxisome proliferator-activated receptor-γ polymorphisms in polycystic ovary syndrome. J Clin Endocrinol Metab 2003;88:5887-92.
23. Meirhaeghe A, Fajas L, Helbecque N, Cottel D, Lebel P, Dallongeville P, et al. A genetic polymorphism of the peroxisome proliferator-activated receptor γ gene influences plasma leptin levels in obese humans. Hum Mol Gen 1998;7:435-40.
24. Wang XL, Oosterhof J, Duarte N. Peroxisome proliferator-activated receptor gamma C161T polymorphism and coronary artery disease. Cardiovasc Res 1999;44:588-94.
25. Orio F Jr, Palomba S, Cascella T, Di Biase S, Labella D, Russo T, et al. Lack of an association between peroxisome proliferator-activated receptor-γ gene Pro12Ala polymorphism and adiponectin levels in the polycystic ovary syndrome. J Clin Endocrinol Metab 2004;89:5110-5.
26. Masud S, Ye S. Effect of the peroxisome proliferator activated receptor-gamma gene Pro12Ala variant on body mass index: a meta-analysis. J Med Genet 2003;40:773-80.
27. Tönjes A, Scholz M, Loeffler M, Stumvoll M. Association of Pro12Ala polymorphism in peroxisome proliferator-activated receptor gamma with pre-diabetic phenotypes: meta-analysis of 57 studies on nondiabetic individuals. Diabetes Care 2006;29:2489-97.