Contact

Daria Pašalić
Editor-in-Chief
Department of Medical Chemistry, Biochemistry and Clinical Chemistry
Zagreb University School of Medicine
Šalata ul 2.
10 000 Zagreb, Croatia
Phone +385 (1) 4590 205; +385 (1) 4566 940
E-mail: dariapasalic [at] gmail [dot] com

Useful links

Izvorni stručni članak:

Maruška Marušić Vrsalović1, Rajko Kušec1,2, Vlatko Pejša2, Željko Romić1. Usporedba osjetljivosti ugnježđene PCR i kvantitativne PCR u određivanju Bcr-Abl p210 prijepisa kronične mijeloične leukemije. Biochemia Medica 2007;17(1):109-14.
 
1Kliničk izavod z alaboratorijsku dijagnostiku, Klinička bolnicaDubrava”, Zagreb
2Odjel za hematologiju, Klinika za unutarnje bolesti, Klinička bolnica “Dubrava”, Zagreb
 
Corresponding author: maruskamarusic [at] hotmail [dot] com
 
Sažetak
 
Uvod: Za otkrivanje minimalne ostatne bolesti u bolesnika s kroničnom mijeloičnom leukemijom (KML) koji su postigli potpunu kliničku remisiju i potpun citogenetski odgovor može se primijenitiugnježđena PCR (engl. nested PCR, nPCR) i kvantitativna PCR u stvarnom vremenu (engl. quantitative real-time PCR, qPCR). Cilj liječenja je postizanje molekularne remisije, pa postizanje visoke osjetljivosti molekularne pretrage ima presudnu ulogu i kliničku primjenu. Usporedili smo razinu osjetljivosti nPCR i qPCR u otkrivanju BCR-ABL p210 prijepisa u modelu razrjeđenja Bcr/Abl-pozitivnih stanica.
Materijal i metode: Za određivanje razine osjetljivosti načinjena su serijska razrjeđenja stanične linije K562 (Bcr-Abl pozitivne) sa staničnom linijom NB4 (Bcr-Abl negativnom) (raspon razrjeđenja pozitivnih stanica: 10-3-10-7). Izolirani uzorci RNA prepisani su u cDNA i testirani na p210 prijepis pomoću nPCR i qPCR. Objema metodama također su ispitani uzorci koštane srži i periferne krvi dvoje bolesnika s KML na terapiji imatinib-mesilatom.
Rezultati: U testu staničnog razrjeđenja nPCR je pokazala osjetljivost za otkrivanje Bcr-Abl pozitivnih stanica od 10-5, dok je qPCR pokazala osjetljivost od 10-6. Obje su metode otkrile p210 prijepise u uzorcima koštane srži bolesnika s KML. Međutim, qPCR je uz to otkrila prijepise i u uzorcima periferne krvi, no uz nižu razinu prijepisa u usporedbi s uzorcima koštane srži.
Zaključak: Iako se često navodi kako je nPCR za otprilike 1 log osjetljivija od qPCR, u našem pokusu s razrjeđenjem na biljeg pozitivne stanične linije K562 dokumentirali smo višu osjetljivost za standardiziranu metodu qPCR, koja je razvijena za potrebe Europskog programa za borbu protiv karcinoma.
Ključne riječi: nPCR, qPCR, osjetljivost, otkrivanje p210
 
Uvod
 
Posljednjega desetljeća je velik broj studija pokazao kako otkrivanje vrlo niskih brojeva malignih stanica, tj. otkrivanje minimalne ostatne bolesti (MRD), značajno korelira s kliničkim ishodom kod mnogih hematoloških malignih bolesti (1). Kod većine bolesnika s novo dijagnosticiranom kroničnom mijeloičnom leukemijom (KML) može se terapijom imatinib mesilatom postići potpun citogenetski odgovor (CCR). Međutim, u dijela ovih bolesnika dolazi do recidiva zbog tvrdokorne populacije malignih stanica prisutne ispod granice otkrivanja standardnim tehnikama. To ukazuje na to da je cilj terapije postizanje molekularne remisije, pa je od presudne važnosti i za kliničku primjenu steći visoku osjetljivost molekularnih pretraga. Idealno bi tehnike koje se rabe za otkrivanje MRD trebale imati razinu osjetljivosti u rasponu od 10-5 do 10-6, biti primjenjive u svih bolesnika s ovom bolešću, pružiti stanovitu kvantifikaciju biljega, biti brze, ne preskupe i lako standardizirane (2). Uz to, od velike je važnosti dobra međulaboratorijska ponovljivost i standardizacija nalaza.
Kod bolesnika s KML koji su postigli CCR prema citogenetici koštane srži i/ili FISH, ugnježđena PCR (nPCR) i kvantitativna PCR u stvarnom vremenu (qPCR) rabe se za otkrivanje BCR-ABL mRNA. Izvješća o osjetljivosti i uporabi nPCR i qPCR u motrenju razina prijepisa BCR/ABL nisu dosljedna (3,4).
U ovoj studiji usporedili smo razinu osjetljivosti nPCR i qPCR u otkrivanju BCR-ABL p210 prijepisa u kontroliranom pokusu s modelom razrjeđivanja BCR-ABL pozitivnih stanica. Isto tako smo usporedili i opisali dva pristupa u qPCR: apsolutnu i relativnu kvantifikaciju.
 
Materijali i metode
Razrjeđenja staničnih linija
Za određivanje razine osjetljivosti načinjena su serijska razrjeđenja stanične linije K562 (BCR-ABL pozitivne) sa staničnom linijom NB4 (BCR-ABL negativnom). Razrjeđenja pozitivnih stanica su bila deseterostruka, od 10-3 (jedna pozitivna stanica u 1000 negativnih) do 10-7 (jedna pozitivna stanica u 10 milijuna negativnih). Objema metodama ispitani su i uzorci koštane srži i periferne krvi dvoje bolesnika s KML na terapiji imatinib mesilatom.
Izolacija RNA i obrnuti prijepis
RNA je izolirana uz primjenu seta QIAamp RNA Blood Mini Kit (QIAGEN, Hilden, Njemačka) prema uputama proizvođača. Za sintezu cDNA upotrebljen je jedan mikrogram ukupne RNA uz primjenu seta GeneAmp Gold RNA PCR Core Kit (Applied BioSystems, New Jersey, SAD) prema uputama proizvođača.
Otkrivanje BCR/ABL prijepisa p210
Test ugnježđene PCR proveden je prema protokolu BIOMED-1 (5). PCR je izvedena sa slijedećim početnicama: prvi korak: BCR-b1-A GAAGTGTTTCAGAAGCTTCTC C plus ABL-a3-B GTTTGGGCTTCACACCAT TCC, drugi korak: BCR-b2-C CAGATGCTGACCAACTCGTGT plus ABL-a3-D TTCCCCATTGTGATTATAGCCTA. Obje faze PCR provedene su u reakcijskom volumenu od 25 μL koji je sadržavao: 1x reakcijski pufer (50 mM KCl, 20 mM Tris HCl, pH 8,3), 1,5 mM MgCl2, 200 μM dNTP, 10 pmol svake početnice, 0,5 U Taq DNA polimeraze (Applied BioSystems, New Jersey, SAD) i 1 μL cDNA u prvoj fazi ili 1 μL PCR iz prve faze u drugoj fazi. PCR umnažanje provedeno je pod slijedećim uvjetima: početna faza od pet minuta kod 95 °C, tada 35 ciklusa od 95°C kroz 30 sekunda, 65 °C kroz jednu minutu, 72°C kroz jednu minutu, potom konačna faza ekstenzije kod 72°C kroz 7 minuta. Proizvodi PCR analizirani su na 2%-tnom agaroznom gelu (Applied BioSystems, New Jersey, SAD) obojanom etidij-bromidom (Sigma Chemical Co., Deisenhofen, Njemačka).
Test QPCR proveden je prema protokolu EAC uz primjenu početnica i probi za tehnologiju TaqMan (6). Analiza PCR u stvarnom vremenu za BCR-ABL i unutarnji “kućepaziteljski” gen (engl. housekeeping gene) ABL provedena je uz primjenu sustava 7300 Real Time PCR System (Applied BioSystems, New Jersey, SAD) uz početne faze od po 2 minute kod 50 °C i 10 minuta kod 95 °C,potom 50 ciklusa od po 15 sekunda kod 95°Ci 1 minutu kod 60°C. Primijenjena su dva pristupa kod qPCR: apsolutna kvantifikacija (omjeri broja kopija) i relativna kvantifikacija. Za apsolutnu kvantifikaciju upotrebljene su standardne plazmidne krivulje (Ipsogen, Luminy Biotech Enterprises, Marseilles, Francuska). Kako bi se poništile razlike između PCR u studiji relativne kvantifikacije, provedena je normalizacija ciljnoga gena (BCR-ABL) pomoću endogene kontrole (ABL). Sve su ekspresije izračunate uz primjenu programa 7300 System SDS Software RQ Study Application (Applied BioSystems, New Jersey, SAD).
 
Rezultati
 
U testu razrjeđenja BCR-ABL pozitivnih stanica nPCR je otkrila p210 prijepis u razrjeđenju 10-5 (slika 1.) u 3 neovisna pokusa. Kod pristupa apsolutne kvantifikacije omjer broja kopija izražen je kao kopije BCR-ABL za kopiju ABL. Kod pristupa relativne kvantifikacije rezultati su prikazani kao relativna ekspresija normaliziranog ciljnoga gena u razrijeđenim staničnim linijama i bolesničkim uzorcima u odnosu na normaliziranu ekspresiju ciljnoga gena u nerazrijeđenoj staničnoj liniji K562. Oba pristupa kod qPCR pokazala su osjetljivost od 10-6 (slika 2., tablica 1.). I ugnježđena i kvantitativna metoda otkrile su p210 prijepis u uzorcima koštane srži bolesnika s KML. Međutim, za razliku od nPCR, qPCR je također otkrila prijepise p210 u uzorcima periferne krvi bolesnika s KML bez obzira na primijenjeni pristup. Razine prijepisa bile su niže u usporedbi s uzorcima koštane srži. Analiza uzoraka u 3 neovisna pokusa pokazala je kako su ovi testovi ponovljivi (srednja razlika triju mjerenja bila je 0,16% za apsolutnu kvantifikaciju i 0,18% za relativnu kvantifikaciju; standardna devijacija za apsolutnu kvantifikaciju bila je 2,1%, a za relativnu kvantifikaciju 2,0%).
 
Slika 1. Agarozni gel obojane tidij-bromidom s rezultatima otkrivanja BCR-ABLp210 prijepisa u serijskim razrjeđenjima stanične linije K562 sastaničnom linijom NB4 i u dvoje bolesnika na terapiji imatinib mesilatom pomoću nPCR. MMW = biljeg molekularne težine; 1 = nerazrijeđena stanična linijaK562; 2 = razrjeđenje 10-3; 3 = razrjeđenje 10-4; 4 = razrjeđenje 10-5; 5 = razrjeđenje 10-6; 6 = razrjeđenje 10-7; 7 = stanična linija NB4; 8 i 9 = voda.
 
Slika 2. Otkrivanje BCR-ABL p210 prijepisa u serijskim razrjeđenjima stanične linije K562 sa staničnom linijom NB4 i u dvoje bolesnika na terapiji imatinib mesilatom pomoćuq PCR uz primjenu tehnologije TaqMan (relativna kvantifikacija, kalibrator: nerazrijeđena stanična linija K562). BM = koštana srž; PB = periferna krv.
 
Tablica 1. Omjer broja kopija BCR-ABL p210 prijepisa u serijskim razrjeđenjima stanične linije K562 sa staničnom linijom NB4 i kod dva bolesnika na terapiji imatinib mesilatom određeni korištenjem TaqMan tehnologije. Svijetlo sivo = u području minimalnog molekularnog odgovora, tamno sivo = u području značajnog molekularnog odgovora (prema referencama 7. i 8.), BM = koštana srž, PB = periferna krv.
 
 
Rasprava
 
Prema protokolu BIOMED-1 osjetljivost od 10-6 može se postići primjenom nPCR. Niža osjetljivost našega testa nPCR u usporedbi s protokolom BIOMED-1 može se pripisati pokusu s različitim načinom razrjeđenja. U protokolu BIOMED-1 je K562 RNA razrijeđena u HL60 RNA (RNA u RNA), dok su u našem pokusu razrjeđivanja stanice K562 razrijeđene u stanicama NB4 (stanice u stanicama). Na taj smo način eksperimentalne uvjete učinili sličnijima situaciji in vivo. Pred-PCR faze kao što su izolacija RNA i učinkovitost obrnutog prijepisa mogu također biti izvori niže osjetljivosti (9,10).
Obje metode postigle su prihvatljivu osjetljivost za otkrivanje MRD kod KML. Međutim, qPCR je pokazala veću osjetljivost nego nPCR. Osjetljivost koja se može dobiti analizom PCR ovisi o nekoliko parametara, koji uključuju broj ispitivanih stanica, ukupnu količinu ispitivane RNA i broj ciklusa PCR (11). Ove razlike između PCR mogu se nadoknaditi upotrebom normaliziranja ciljnoga gena endogenom kontrolom (ABL, GADPH, B2M). Uz višu osjetljivost, prednosti qPCR pred standardnom nPCR za otkrivanje prijepisa p210 uključuju skraćeno vrijeme od prijema uzorka do izdavanja nalaza, smanjenu mogućnost kontaminacije poslije PCR, smanjenu varijabilnost rezultata (prikupljanje podataka obavlja se u eksponencijalnoj fazi reakcije PCR), visok protok i mogućnost dobivanja kvantitativnih rezultata. U našem pokusu su i metoda apsolutne kao i metoda relativne kvantifikacije pokazale jednaku osjetljivost. Mogući nedostatci metode apsolutne kvantifikacije su to što primjena plazmidnih standarda smanjuje broj jažica raspoloživih za bolesničke uzorke, i povećava opasnost od onečišćenja, te nešto viši troškovi. Relativna kvantifikacija zasniva se na relativnoj učinkovitosti umnažanja ciljnoga i kontrolnog gena, pa je preduvjet rutinsko uključenje prvog dijagnostičkog uzorka bolesnika. Na taj se način ovu metodu može primjenjivati za određivanje relativne razine MRD u usporedbi s dijagnostičkim uzorkom. Bez obzira rabi li se apsolutna ili relativna kvantifikacija, određivanje kretanja kvantitativnih brojeva ostatnih BCR-ABL pozitivnih stanica kroz određeno razdoblje pruža važne terapijske podatke u praćenju bolesnika s KML. U zaključku, utvrdili smo kako je qPCR primjerena, ponovljiva i pouzdana metoda za motrenje MRD nakon postizanja CCR kod kronične mijeloične leukemije.
 
Literatura
 
1.     Szczepanski T, Orfao A, van der Velden VH, San Miguel JF, van Dongen JJ. Minimal residual disease in leukaemia patients. Lancet Oncol 2001;2:409-17.
2.     Braziel RM, Shipp MA, Feldman AL, Espina V, Winters M, Jaffe ES, et al. Molecular diagnostics. Hematology 2003; Am Soc Hematol Educ Program: 279-93.
3.     Guo JQ, Lin H, Kantarjian H, Talpaz M, Champlin R, Andreeff M, et al. Comparison of competitive-nested PCR and real-time PCR in detecting BCR-ABL fusion transcripts in chronic myeloid leukemia patients. Leukemia 2002;16:2447-53.
4.     Kim YJ, Kim DW, Lee S, Kim HJ, Kim YL, Hwang JY, et al. Comprehensive comparison of FISH, RT-PCR, and RQ-PCR for monitoring the BCR-ABL gene after hematopoietic stem cell transplantation in KML. Eur J Haematol 2002;68:272-80.
5.     van Dongen JJ, Macintyre EA, Delabesse E, Rossi V, Saglio G, Gottardi E, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 1999;13:1901-28.
6.     Gabert J, Beillard E, van der Velden VHJ, Bi W, Grimwalde D, Pallisgaard N, et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia – A Europe Against Cancer Program. Leukemia 2003;17:2318-57.
 7.   Hughes TP, Kaeda J, Branford S, Rudzki Z, Hochhaus A, Hensley M, et al. Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newly diagnosed chronic myeloid leukemia. N Engl J Med 2003;349:1423-32.
 8.   Hughes T, Deininger M, Hochhaus A, Branford S, Radich J, Kaeda J, et al. Monitoring KML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results. Blood 2006;108:28-37.
 9.   Bustin SA, Nolan T. Pitfalls of quantitative real-time reverse-transcription polymerase chain-reaction. J Biomol Tech 2004;15:155-66.
10.   Branford S, Cross NCP, Hochhaus A, Radich J, Saglio G, Kaeda J, et al. Rationale for the recommendations for harmonizing current methodology for detecting BCR-ABL transcripts in patients with chronic myeloid leukaemia. Leukemia 2006;20:1925-30.
11.   van der Velden VHJ, Hochhaus A, Cazzaniga G, Szczepanski T, Gabert J, van Dongen JJM. Detection of minimal residual disease in hematologic malignancies by real-time quantitative PCR: principles, approaches, and laboratory aspects. Leukemia 2003;17:1013-34.